Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy

Nur Ma'alifah, Luqman Qurata Aini, Abdul Latief Abadi, Kestrilia Rega Prillianti, Matheus Randy Prabowo

Abstract


Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.


Keywords


Ralstonia solanacearum, FTIR spectroscopy, characterization, detection, biomarkers.

Full Text:

PDF

References


Davis, R., & Mauer, L. (2010). Fourier transform infrared (FT-IR) spectroscopy: a rapid tool for detection and analysis of foodborne pathogenic bacteria. Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology. A. Méndez-Vilas (Ed.), 1, 1582-1594. https://www.researchgate.net/publication/257781807_Fourier_Transform_Infrared_FT-IR_Spectroscopy_A_Rapid_Tool_for_Detection_and_Analysis_of_Foodborne_Pathogenic_Bacteria

Doyle, J. J., & Doyle, J. (1990). Isolation of plant DNA from fresh tissue. Focus, 12(1), 1315 . https://www.scienceopen.com/document?vid=46e6093b-769a-467f-be1a-fd0c2ecfa9c0

Hayward, A. C. (1991). Biology and epidemiology of bacterial wilt caused by Pseudomonas solanacearum. Annual Review of Phytopathology, 29, 65–87. https://doi.org/10.1146/annurev.py.29.090191.000433

Huleihel, M., Shufan, E., Tsror, L., Sharaha, U., Lapidot, I., Mordechai, S., & Salman, A. (2018). Differentiation of mixed soil-borne fungi in the genus level using infrared spectroscopy and multivariate analysis. Journal of Photochemistry and Photobiology B: Biology, 180, 155–165. https://doi.org/10.1016/j.jphotobiol.2018.02.007

Kago, K. E., Kinyua, M. Z., Okemo, O. P., & Muthini, M. J. (2016). Bacterial Wilt, A Challenge in Solanaceous Crops Production At Kenyan Highlands and Lowlands. Bacterial Wilt, 3(1), 06-11. https://www.neliti.com/publications/262932/bacterial-wilt-a-challenge-in-solanaceous-crops-production-at-kenyan-highlands-a

Naumann, D., Helm, D., & Labischinski, H. (1991). Microbiological characterizations by FT-IR spectroscopy. Nature, 351(6321), 81-82. https://doi.org/10.1038/351081a0

Naumann, A., Navarro-González, M., Peddireddi, S., Kües, U., & Polle, A. (2005). Fourier transform infrared microscopy and imaging: Detection of fungi in wood. Fungal Genetics and Biology, 42(10), 829–835. https://doi.org/10.1016/j.fgb.2005.06.003

Maity, J. P., Kar, S., Lin, C. M., Chen, C. Y., Chang, Y. F., Jean, J. S., & Kulp, T. R. (2013). Identification and discrimination of bacteria using Fourier transform infrared spectroscopy. Spectrochimica Acta - Part A: Molecular and Biomolecular Spectroscopy, 116, 478-484. https://doi.org/10.1016/j.saa.2013.07.062

Maquelin, K., Kirschner, C., Choo-Smith, L. P., van den Braak, N., Endtz, H. P., Naumann, D., & Puppels, G. J. (2002). Identification of medically relevant microorganisms by vibrational spectroscopy. Journal of Microbiological Methods, 51(3), 255-271. https://doi.org/10.1016/S0167-7012(02)00127-6

Opina, N., Tavner, F., Hollway, G., Wang, J-F., Li, T. H., Maghirang, R., Fegan, M., Hayward, A. C., Krishnapillai, V., Hong, W. F., Holloway, B., Timmis, J. (1997). A novel method for development of species strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum). Asia Pac J Mol Biol Biotechnol., 5, 19-30. https://www.researchgate.net/publication/37625749_A_novel_method_for_development_of_species_strain-specific_DNA_probes_and_PCR_primers_for_identifying_Burkholderia_solanacearum_formerly_Pseudomonas_solanacearum

Salman, A., Shufan, E., Huleihel, M., & Lapidot, I. (2014). Differentiation of mixed bacteria samples in the generic level using infrared spectroscopy and multivariate analysis. 2014 IEEE 28th Convention of Electrical and Electronics Engineers in Israel, IEEEI 2014. https://doi.org/10.1109/EEEI.2014.7005863

Salman, A., Shufan, E., Sharaha, U., Lapidot, I., Mordechai, S., & Huleihel, M. (2019). Distinction between mixed genus bacteria using infrared spectroscopy and multivariate analysis. Vibrational Spectroscopy, 100, 6-13. https://doi.org/10.1016/j.vibspec.2018.10.009

Salman, A., Tsror, L., Pomerantz, A., Moreh, R., Mordechai, S., & Huleihel, M. (2010). FTIR spectroscopy for detection and identification of fungal phytopathogenes. Spectroscopy, 24(3–4), 261–267. https://doi.org/10.3233/SPE-2010-0448

Setiawan, A. W. (2019). Bacterial Wilt Epidemiology and Development of RalstoniasolanacearumComplex Species. Jurnal Galung Tropika. 8(3). 243-270. https://www.jurnalpertanianumpar.com/index.php/jgt/article/view/502/pdf_67

Skolik, P., Morais, C. L. M., Martin, F. L., & McAinsh, M. R. (2020). Attenuated total reflection Fourier-transform infrared spectroscopy coupled with chemometrics directly detects pre- and post-symptomatic changes in tomato plants infected with Botrytis cinerea. Vibrational Spectroscopy, 111. https://doi.org/10.1016/j.vibspec.2020.103171

Zarnowiec, P., Lechowicz, L., Czerwonka, G., & Kaca, W. (2015). Fourier Transform Infrared Spectroscopy (FTIR) as a Tool for the Identification and Differentiation of Pathogenic Bacteria. Current Medicinal Chemistry, 22(14), 1710-1718. https://doi.org/10.2174/0929867322666150311152800




DOI: https://doi.org/10.21776/ub.rjls.2022.009.02.2

Refbacks

  • There are currently no refbacks.


Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.